Analysis of salt tolerance in BpmiR156 overexpression Betula platyphylla

doi:10.3969/j.issn.1000-2006.201908006

JOURNAL OF NANJING FORESTRY UNIVERSITY ›› 2020, Vol. 44 ›› Issue (6): 147-151.doi: 10.3969/j.issn.1000-2006.201908006

Previous Articles Next Articles

Analysis of salt tolerance in BpmiR156 overexpression Betula platyphylla

YE Zhalong(), YAN Bin, SHEN Tingting, NING Kun, LI Huiyu^*()

State Key Laboratory of Tree Genetics and Breeding,Northeast Forestry University,Harbin 150040,China

Received:2019-08-04 Revised:2020-04-07 Online:2020-11-30 Published:2020-12-07
Contact: LI Huiyu E-mail:1520045960@qq.com;lihuiyu2017@126.com

Abstract

Abstract:

【Objective】This study aimed to explore the role of miR156, an age-response factor in plants, in Betula platy-phylla (birch) salt tolerance.【Method】Transgenic BpmiR156 overexpression lines and non-transgenic line were generated. The polymerase chain reaction (PCR) and quantitative PCR were used to analyze the stability and expression of the exogenous BpmiR156 in each transgenic line. Under NaCl stress, the salt injury index, physiological index and growth rate of transgenic and non-transgenic lines were analyzed. 【Result】Results indicated that the BpmiR156 was integrated into the genome of the transgenic lines and more highly expressed than those in the non-transgenic line. Following NaCl treatment, the contents of H₂O₂, MDA and the salt injury index were higher in the transgenic lines than those in the non-transgenic line. Moreover, the transgenic lines exhibited a slower growth rate than the non-transgenic line. 【Conclusion】BpmiR156 gene was stably expressed in transgenic birch. Compared with the non-transgenic line, the index of salt injury increased, the growth rate slowed down and the membrane system damage was more serious. This indicates that over-expression of miR156 reduces the salt tolerance of birch.

Key words: Betula platyphylla (birch), miR156, transgenic lines, salt stress, malondialdehyde (MDA), H₂O₂

CLC Number:

S762.3 ⁺6

YE Zhalong, YAN Bin, SHEN Tingting, NING Kun, LI Huiyu. Analysis of salt tolerance in BpmiR156 overexpression Betula platyphylla[J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(6): 147-151.

Figures/Tables 7

Table 1

Fig.1

Fig.2

Fig.3

Fig.4

Fig.5

Fig.6

References 29

[1]	BARTEL D P. MicroRNAs: Genomics,biogenesis,mechanism, and function[J]. Cell, 2004,116(2):281-297. DOI: 10.1016/s0092-8674(04)00045-5.
[2]	LEE R C, FEINBAUM R L, AMBROS V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14[J]. Cell, 1993,75(5):843-854. DOI: 10.1016/0092-8674(93)90529-y.
[3]	REINHART B J, SLACK F J, BASSON M, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans[J]. Nature, 2000,403(6772):901-906.DOI: 10.1038/35002607. doi: 10.1038/35002607 pmid: 10706289
[4]	SUNKAR R, ZHU J K. Novel and stress-regulated micro RNAs and other small RNAs from Arabidopsis[J]. Plant Cell, 2004,16(8):2001-2019. DOI: 10.1105/tpc.104.022830.
[5]	BIRKENBIHLR P, JACH G, SAEDLER H, et al. Functional dissection of the plant-specific SBP-domain: overlap of the DNA-binding and nuclear localization domains[J]. Journal of Molecular Biology, 2005,352(3):585-596. DOI: 10.1016/j.jmb.2005.07.013.
[6]	JIAN X Y, ZHANG L, LI G L, et al. Identification of novel stress-regulated micro RNAs from Oryza sativa L[J]. Genomics, 2010,95(1):47-55. DOI: 10.1016/j.ygeno.2009.08.017. pmid: 19796675
[7]	REINHART B J, WEINSTEINE G, RHOADESM W, et al. MicroRNAs in plants[J]. Genes Dev, 2002,16(13):1616-1626. DOI: 10.1101/gad.1004402. doi: 10.1101/gad.1004402 pmid: 12101121
[8]	WANG J W, CZECH B, WEIGEL D. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana[J]. Cell, 2009,138(4):738-749. DOI: 10.1016/j.cell.2009.06.014.
[9]	WU G, PARK M Y, CONWAY S R, et al. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis[J]. Cell, 2009,138(4):750-759. DOI: 10.1016/j.cell.2009.06.031.
[10]	CHUCKG, CIGANA M, SAETEURN K, et al. The heterochronic maize mutant corngrass1 results from overexpression of a tandem microRNA[J]. Nat Genet, 2007,39(4):544-549. DOI: 10.1038/ng2001. pmid: 17369828
[11]	HIBARA K, ISONO M, MIMURA M, et al. Jasmonate regulates juvenile-to-adult phase transition in rice. Development. 2016,143(18):3407-16. DOI: 10.1242/dev.138602.
[12]	WANG J W, PARK M Y, WANGL J, et al. miRNA control of vegetative phase change in trees[J]. PLoS Genet, 2011,7(2):e1002012. DOI: 10.1371/journal.pgen.1002012.
[13]	YANG L, XU M, KOO Y, et al. Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C[J]. e Life, 2013,2:e00260.DOI: 10.7554/eLife.00260.
[14]	LIU B X, WANG Z G, LIANG H Y, et al. Effects of salt stress on physiological characters and salt-tolerance of Ulmus pumila in different habitats[J]. Chin J Appl Ecol, 2012,23(6):1481-1489.DOI: 10.13287/j.1001-9332.2012.0248.
[15]	GUOLEI LI. Response characteristics of 13 tree species to salt stress[D]. Tai’an: Shandong Agricultural University. 2004,3:18-22.
[16]	LIU Y, LI D, YAN J, et al. MiR319 mediated salt tolerance by ethylene[J]. Plant Biotechnol J. 2019,17(12):2370-2383. DOI: 10.1111/pbi.13154.
[17]	WóJCIK AM, GAJ MD. miR393 contributes to the embryogenic transition induced in vitro in Arabidopsis via the modification of the tissue sensitivity to auxin treatment[J]. Planta. 2016 , 244(1):231-43. DOI: 10.1007/s00425-016-2505-7. pmid: 27040841
[18]	XIA K, WANG R, OU X, et al. OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers,early flowering and less tolerance to salt and drought in rice[J]. PLoS One. 2012,7(1):e30039. DOI: 10.1371/journal.pone.0030039.
[19]	YU Y, NI Z, WANG Y, et al. Overexpression of soybean miR169c confers increased drought stress sensitivity in transgenic Arabidopsis thaliana[J]. Plant Sci, 2019,285:68-78.DOI: 10.1016/j.plantsci.2019.05.003.
[20]	WANG W, LIU D, CHEN D D, et al. MicroRNA414c affects salt tolerance of cotton by regulating reactive oxygen species metabolism under salinity stress. RNA Biol. 2019,16(3):362-375. DOI: 10.1080/15476286.2019.1574163.
[21]	GAO P, BAI X, YANG L, et al. Over-expression of osa-MIR396c decreases salt and alkali stress tolerance[J]. Planta, 2010,231(5):991-1001. DOI: 10.1007/s00425-010-1104-2.
[22]	MACOVEI A, TUTEJA N. MicroRNAs targeting DEAD-box helicases are involved in salinity stress response in rice(Oryza sativa L.)[J]. BMC Plant Biol, 2012,12:183.DOI: 10.1186/1471-2229-12-183. pmid: 23043463
[23]	STEIF A, ALTMANN S, HOFFMANN K, et al. Arabidopsis miR156 regulates tolerance to recurring environmental stress through SPL transcription factors[J]. Plant Cell, 2014,26(4):1792-1807.DOI: 10.1105/tpc.114.123851.
[24]	KANG T, YU C Y, LIU Y, et al. Subtly manipulated expression of ZmmiR156 in tobacco improves drought and salt tolerance without changing the architecture of transgenic plants[J]. Front Plant Sci, 2020,10:1664. DOI: 10.3389/fpls.2019.01664. pmid: 31998347
[25]	ZHOU M, TANG W. MicroRNA156 amplifies transcription factor-associated cold stress tolerance in plant cells[J]. Mol Genet Genomics, 2019,294(2):379-393. DOI: 10.1007/s00438-018-1516-4.
[26]	ARSHAD M, FEYISSAB A, AMYYOT L, et al. MicroRNA156 improves drought stress tolerance in alfalfa (Medicago sativa) by silencing SPL13[J]. Plant Sci, 2017,258:122-136. DOI: 10.1016/j.plantsci.2017.01.018. doi: 10.1016/j.plantsci.2017.01.018 pmid: 28330556
[27]	MATTHEWS C, ARSHAD M, HANNOUFA A. Alfalfa response to heat stress is modulated by microRNA156[J]. Physillogia Plantarum. 2019,165(4), 830-842. DOI: 10.1111/ppl.12787.
[28]	FEYISSA B A, ARSHAD M, GRUBER M Y, et al. The interplay between miR156/SPL13 and DFR/WD40-1 regulate drought tolerance in alfalfa[J]. BMC Plant Biol. 2019,19(1):434. DOI: 10.1186/s12870-019-2059-5. doi: 10.1186/s12870-019-2059-5 pmid: 31638916
[29]	NING K, CHEN S, HUANG H J, et al. Molecular characterization and expression analysis of the SPL gene family with BpSPL9 transgenic lines found to confer tolerance to abiotic stress in Betula platyphylla Suk[J]. Plant Cell Tiss Organ Cult, 2017,130:469-481. DOI: 10.1007/s11240-017-1226-3.

Related Articles 15

[1]	LU Zhiguo, HUA Jianfeng, YIN Yunlong, SHI Qin. Effects of nitrogen form on growth and physiological characteristics of Hibiscus hamabo under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2022, 46(3): 91-98.
[2]	MA Shilin, CAO Pengxiang, ZHANG Jinchi, LIU Jing, WANG Jinping, ZHU Lingjun, YUAN Zhongming. Effects of AMF on the growth and photosynthetic characteristics of Zelkova serrata under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2022, 46(1): 122-130.
[3]	SHE Jianwei, ZHANG Kang, ZHENG Xu, ZHAO Xiaojun, CHENG Fang, TANG Luozhong. Effects of seawater on growth and physiology of Betula microphylla var. paludosa cutting seedlings [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2021, 45(5): 102-108.
[4]	LI Mengjuan, ZHU Liming, HUO Junnan, ZHANG Jingbo, SHI Jisen, CHENG Tielong. Cloning and expression analyses of NtCBL1,NtCBL2 gene of Nitraria tangutorum [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2021, 45(3): 93-99.
[5]	CUI Lingjun, LIU Yuxia, LIN Jian, SHI Kaiming. Effects of AMF on photosynthetic characteristics of Phoebe zhennan under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2021, 45(1): 101-106.
[6]	LU Qiang, YANG Ling, WANG Haowei, YUAN Jiaqiu, FU Xiangxiang, FANG Yan. Responses of photosynthetic characteristics and chloroplast ultrastructure to salt stress in seedlings of Cornus hongkongensis subsp. elegans [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(4): 29-36.
[7]	CUI Lingjun, LIU Yuxia, LIN Jian, SHI Kaiming. Effects of arbuscular mycorrhizal fungi on roots growth and endogenous hormones of Phoebe zhennan under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(4): 119-124.
[8]	WANG Haowei, YANG Ling, LU Qiang, FU Xiangxiang. Effects of salt stress on seed germination and seedling growth of Cornus florida [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(3): 89-94.
[9]	ZHANG Heng, LIU Xiaoting, CHEN Song, ZHOU Xueyan, SI Dongjing, LI Ying, ZHAO Xiyang. Analysis of differentially expressed proteins in leaves of triploid Populus simonii × P. nigra hybrid clones under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(2): 59-66.
[10]	LIAO Yangwenke, CUI Rongrong, XIE Yinfeng. The role of β-cyanoalanin synthase in polar leaves under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2019, 43(6): 137-142.
[11]	ZHOU Qi, ZHU Zunling, SHI Man. Effects of salt stress on growth,physiological and biochemical characteristics of Carpinus turczaninowii seedlings [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2015, 39(06): 56-60.
[12]	ZHANG Zihan, WANG Jiayuan, YU Fangyuan. Effects of NaCl stress on germination characteristics of Melia azedarach L. seeds from two provenances [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2014, 38(05): 107-112.
[13]	ZHANG Huihui, ZHANG Xiuli, WANG Juan, TIAN Ye, LI Xin, HU Juwei, SUN Guangyu. A comprehensive evaluation of salt resistance in three clove varieties by the fast fluorescence transient parameters [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2013, 37(05): 13-19.
[14]	LIU Yilin, WAN Fuxu, LOU Xiaorui. Effects of salt stress on physiological and biochemical index of ten provenances of Cupressus lusitanica [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2013, 37(04): 29-33.
[15]	CHENG Shujuan,TANG Dongqin,LIU Qunlu. Reactive oxygen species homeostasis of two Lonicera species under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2013, 37(01): 137-141.

Metrics

Comments

www.nldxb.njfu.edu.cn

Edited ＆ Published by Editorial Department of Nanjing Forestry University(Natural Sciences Edition)
Address： No.159 Longpan Road,Nanjing 210037 Jiangsu,P.R.China
E-mail ：xuebao@njfu.edu.cn , xuebao@njfu.com.cn
Telephone +86-25-85428247,85427076
Distributed by China International Book Trading Corporation P.O. Box 399, Beijing ,P.R. China

引物名称 primer name	引物序列 primer sequence	用途 using
miR156-F	5'-CACC GTTTCCACATCTGGGAATAAGC3'	PCR 检测 PCR detection
miR156-R	5'-TCAGCAGCTGTTGAAGTTGAAGG3'
pGWB2-F	5'-ACCACGTCTTCAAAGCAAGTGG 3'
pGWB2-R	5'-GGAAATTCCTCTCCTGTCAGACG 3'
qmiR156-F	5'-TTGACAGAAGAGAGTGAGCACACA-3'	qPCR 检测 qPCR detection
qmiR156-R	5'-GCTTGACAGAAGAtAGaGAGCACAA-3'
U6-F	5'-GGTCCTTCGGGACATCCGAT-3'
U6-R	5'-GGGACCATTTCTCGATTTATGCGTG-3'

Analysis of salt tolerance in BpmiR156 overexpression Betula platyphylla

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 29

Related Articles 15

Recommended Articles

Metrics

Comments

Author

Reader

Reviewer