JOURNAL OF NANJING FORESTRY UNIVERSITY ›› 2020, Vol. 44 ›› Issue (6): 147-151.doi: 10.3969/j.issn.1000-2006.201908006
Previous Articles Next Articles
YE Zhalong(), YAN Bin, SHEN Tingting, NING Kun, LI Huiyu*(
)
Received:
2019-08-04
Revised:
2020-04-07
Online:
2020-11-30
Published:
2020-12-07
Contact:
LI Huiyu
E-mail:1520045960@qq.com;lihuiyu2017@126.com
CLC Number:
YE Zhalong, YAN Bin, SHEN Tingting, NING Kun, LI Huiyu. Analysis of salt tolerance in BpmiR156 overexpression Betula platyphylla[J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(6): 147-151.
Table 1
Primer sequences for PCR and qPCR test"
引物名称 primer name | 引物序列 primer sequence | 用途 using |
---|---|---|
miR156-F | 5'-CACC GTTTCCACATCTGGGAATAAGC3' | PCR 检测 PCR detection |
miR156-R | 5'-TCAGCAGCTGTTGAAGTTGAAGG3' | |
pGWB2-F | 5'-ACCACGTCTTCAAAGCAAGTGG 3' | |
pGWB2-R | 5'-GGAAATTCCTCTCCTGTCAGACG 3' | |
qmiR156-F | 5'-TTGACAGAAGAGAGTGAGCACACA-3' | qPCR 检测 qPCR detection |
qmiR156-R | 5'-GCTTGACAGAAGAtAGaGAGCACAA-3' | |
U6-F | 5'-GGTCCTTCGGGACATCCGAT-3' | |
U6-R | 5'-GGGACCATTTCTCGATTTATGCGTG-3' |
[1] | BARTEL D P. MicroRNAs: Genomics,biogenesis,mechanism, and function[J]. Cell, 2004,116(2):281-297. DOI: 10.1016/s0092-8674(04)00045-5. |
[2] | LEE R C, FEINBAUM R L, AMBROS V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14[J]. Cell, 1993,75(5):843-854. DOI: 10.1016/0092-8674(93)90529-y. |
[3] |
REINHART B J, SLACK F J, BASSON M, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans[J]. Nature, 2000,403(6772):901-906.DOI: 10.1038/35002607.
doi: 10.1038/35002607 pmid: 10706289 |
[4] | SUNKAR R, ZHU J K. Novel and stress-regulated micro RNAs and other small RNAs from Arabidopsis[J]. Plant Cell, 2004,16(8):2001-2019. DOI: 10.1105/tpc.104.022830. |
[5] | BIRKENBIHLR P, JACH G, SAEDLER H, et al. Functional dissection of the plant-specific SBP-domain: overlap of the DNA-binding and nuclear localization domains[J]. Journal of Molecular Biology, 2005,352(3):585-596. DOI: 10.1016/j.jmb.2005.07.013. |
[6] |
JIAN X Y, ZHANG L, LI G L, et al. Identification of novel stress-regulated micro RNAs from Oryza sativa L[J]. Genomics, 2010,95(1):47-55. DOI: 10.1016/j.ygeno.2009.08.017.
pmid: 19796675 |
[7] |
REINHART B J, WEINSTEINE G, RHOADESM W, et al. MicroRNAs in plants[J]. Genes Dev, 2002,16(13):1616-1626. DOI: 10.1101/gad.1004402.
doi: 10.1101/gad.1004402 pmid: 12101121 |
[8] | WANG J W, CZECH B, WEIGEL D. miR156-regulated SPL transcription factors define an endogenous flowering pathway in Arabidopsis thaliana[J]. Cell, 2009,138(4):738-749. DOI: 10.1016/j.cell.2009.06.014. |
[9] | WU G, PARK M Y, CONWAY S R, et al. The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis[J]. Cell, 2009,138(4):750-759. DOI: 10.1016/j.cell.2009.06.031. |
[10] |
CHUCKG, CIGANA M, SAETEURN K, et al. The heterochronic maize mutant corngrass1 results from overexpression of a tandem microRNA[J]. Nat Genet, 2007,39(4):544-549. DOI: 10.1038/ng2001.
pmid: 17369828 |
[11] | HIBARA K, ISONO M, MIMURA M, et al. Jasmonate regulates juvenile-to-adult phase transition in rice. Development. 2016,143(18):3407-16. DOI: 10.1242/dev.138602. |
[12] | WANG J W, PARK M Y, WANGL J, et al. miRNA control of vegetative phase change in trees[J]. PLoS Genet, 2011,7(2):e1002012. DOI: 10.1371/journal.pgen.1002012. |
[13] | YANG L, XU M, KOO Y, et al. Sugar promotes vegetative phase change in Arabidopsis thaliana by repressing the expression of MIR156A and MIR156C[J]. e Life, 2013,2:e00260.DOI: 10.7554/eLife.00260. |
[14] | LIU B X, WANG Z G, LIANG H Y, et al. Effects of salt stress on physiological characters and salt-tolerance of Ulmus pumila in different habitats[J]. Chin J Appl Ecol, 2012,23(6):1481-1489.DOI: 10.13287/j.1001-9332.2012.0248. |
[15] | GUOLEI LI. Response characteristics of 13 tree species to salt stress[D]. Tai’an: Shandong Agricultural University. 2004,3:18-22. |
[16] | LIU Y, LI D, YAN J, et al. MiR319 mediated salt tolerance by ethylene[J]. Plant Biotechnol J. 2019,17(12):2370-2383. DOI: 10.1111/pbi.13154. |
[17] |
WóJCIK AM, GAJ MD. miR393 contributes to the embryogenic transition induced in vitro in Arabidopsis via the modification of the tissue sensitivity to auxin treatment[J]. Planta. 2016 , 244(1):231-43. DOI: 10.1007/s00425-016-2505-7.
pmid: 27040841 |
[18] | XIA K, WANG R, OU X, et al. OsTIR1 and OsAFB2 downregulation via OsmiR393 overexpression leads to more tillers,early flowering and less tolerance to salt and drought in rice[J]. PLoS One. 2012,7(1):e30039. DOI: 10.1371/journal.pone.0030039. |
[19] | YU Y, NI Z, WANG Y, et al. Overexpression of soybean miR169c confers increased drought stress sensitivity in transgenic Arabidopsis thaliana[J]. Plant Sci, 2019,285:68-78.DOI: 10.1016/j.plantsci.2019.05.003. |
[20] | WANG W, LIU D, CHEN D D, et al. MicroRNA414c affects salt tolerance of cotton by regulating reactive oxygen species metabolism under salinity stress. RNA Biol. 2019,16(3):362-375. DOI: 10.1080/15476286.2019.1574163. |
[21] | GAO P, BAI X, YANG L, et al. Over-expression of osa-MIR396c decreases salt and alkali stress tolerance[J]. Planta, 2010,231(5):991-1001. DOI: 10.1007/s00425-010-1104-2. |
[22] |
MACOVEI A, TUTEJA N. MicroRNAs targeting DEAD-box helicases are involved in salinity stress response in rice(Oryza sativa L.)[J]. BMC Plant Biol, 2012,12:183.DOI: 10.1186/1471-2229-12-183.
pmid: 23043463 |
[23] | STEIF A, ALTMANN S, HOFFMANN K, et al. Arabidopsis miR156 regulates tolerance to recurring environmental stress through SPL transcription factors[J]. Plant Cell, 2014,26(4):1792-1807.DOI: 10.1105/tpc.114.123851. |
[24] |
KANG T, YU C Y, LIU Y, et al. Subtly manipulated expression of ZmmiR156 in tobacco improves drought and salt tolerance without changing the architecture of transgenic plants[J]. Front Plant Sci, 2020,10:1664. DOI: 10.3389/fpls.2019.01664.
pmid: 31998347 |
[25] | ZHOU M, TANG W. MicroRNA156 amplifies transcription factor-associated cold stress tolerance in plant cells[J]. Mol Genet Genomics, 2019,294(2):379-393. DOI: 10.1007/s00438-018-1516-4. |
[26] |
ARSHAD M, FEYISSAB A, AMYYOT L, et al. MicroRNA156 improves drought stress tolerance in alfalfa (Medicago sativa) by silencing SPL13[J]. Plant Sci, 2017,258:122-136. DOI: 10.1016/j.plantsci.2017.01.018.
doi: 10.1016/j.plantsci.2017.01.018 pmid: 28330556 |
[27] | MATTHEWS C, ARSHAD M, HANNOUFA A. Alfalfa response to heat stress is modulated by microRNA156[J]. Physillogia Plantarum. 2019,165(4), 830-842. DOI: 10.1111/ppl.12787. |
[28] |
FEYISSA B A, ARSHAD M, GRUBER M Y, et al. The interplay between miR156/SPL13 and DFR/WD40-1 regulate drought tolerance in alfalfa[J]. BMC Plant Biol. 2019,19(1):434. DOI: 10.1186/s12870-019-2059-5.
doi: 10.1186/s12870-019-2059-5 pmid: 31638916 |
[29] | NING K, CHEN S, HUANG H J, et al. Molecular characterization and expression analysis of the SPL gene family with BpSPL9 transgenic lines found to confer tolerance to abiotic stress in Betula platyphylla Suk[J]. Plant Cell Tiss Organ Cult, 2017,130:469-481. DOI: 10.1007/s11240-017-1226-3. |
[1] | XU Huihui, BAN Zhuo, WANG Chenxue, BI Quanxin, LIU Xiaojuan, WANG Libing. The identification and functional analysis of BZR1 genes in yellowhorn [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2025, 49(2): 12-22. |
[2] | SONG Zihe, ZHEN Yan. Advancements in the research of miRNAs associated with plant drought and salt stress responses [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2024, 48(4): 1-11. |
[3] | ZONG Jianwei, LI Cheng, ZHANG Jing, YANG Yuhua. Effects of arbuscular mycorrhizal fungi on the growth and physiological characteristics of Xanthoceras sorbifolium under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2024, 48(4): 168-176. |
[4] | LU Zhiguo, HUA Jianfeng, YIN Yunlong, SHI Qin. Effects of nitrogen form on growth and physiological characteristics of Hibiscus hamabo under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2022, 46(3): 91-98. |
[5] | MA Shilin, CAO Pengxiang, ZHANG Jinchi, LIU Jing, WANG Jinping, ZHU Lingjun, YUAN Zhongming. Effects of AMF on the growth and photosynthetic characteristics of Zelkova serrata under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2022, 46(1): 122-130. |
[6] | SHE Jianwei, ZHANG Kang, ZHENG Xu, ZHAO Xiaojun, CHENG Fang, TANG Luozhong. Effects of seawater on growth and physiology of Betula microphylla var. paludosa cutting seedlings [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2021, 45(5): 102-108. |
[7] | LI Mengjuan, ZHU Liming, HUO Junnan, ZHANG Jingbo, SHI Jisen, CHENG Tielong. Cloning and expression analyses of NtCBL1,NtCBL2 gene of Nitraria tangutorum [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2021, 45(3): 93-99. |
[8] | CUI Lingjun, LIU Yuxia, LIN Jian, SHI Kaiming. Effects of AMF on photosynthetic characteristics of Phoebe zhennan under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2021, 45(1): 101-106. |
[9] | LU Qiang, YANG Ling, WANG Haowei, YUAN Jiaqiu, FU Xiangxiang, FANG Yan. Responses of photosynthetic characteristics and chloroplast ultrastructure to salt stress in seedlings of Cornus hongkongensis subsp. elegans [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(4): 29-36. |
[10] | CUI Lingjun, LIU Yuxia, LIN Jian, SHI Kaiming. Effects of arbuscular mycorrhizal fungi on roots growth and endogenous hormones of Phoebe zhennan under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(4): 119-124. |
[11] | WANG Haowei, YANG Ling, LU Qiang, FU Xiangxiang. Effects of salt stress on seed germination and seedling growth of Cornus florida [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(3): 89-94. |
[12] | ZHANG Heng, LIU Xiaoting, CHEN Song, ZHOU Xueyan, SI Dongjing, LI Ying, ZHAO Xiyang. Analysis of differentially expressed proteins in leaves of triploid Populus simonii × P. nigra hybrid clones under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2020, 44(2): 59-66. |
[13] | LIAO Yangwenke, CUI Rongrong, XIE Yinfeng. The role of β-cyanoalanin synthase in polar leaves under salt stress [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2019, 43(6): 137-142. |
[14] | ZHOU Qi, ZHU Zunling, SHI Man. Effects of salt stress on growth,physiological and biochemical characteristics of Carpinus turczaninowii seedlings [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2015, 39(06): 56-60. |
[15] | ZHANG Zihan, WANG Jiayuan, YU Fangyuan. Effects of NaCl stress on germination characteristics of Melia azedarach L. seeds from two provenances [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2014, 38(05): 107-112. |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||