HcAnk1 and HcAnk2 genes function and HcNPV susceptibility of Hyphantria cunea based on RNAi

doi:10.12302/j.issn.1000-2006.202203049

JOURNAL OF NANJING FORESTRY UNIVERSITY ›› 2024, Vol. 48 ›› Issue (3): 181-190.doi: 10.12302/j.issn.1000-2006.202203049

Previous Articles Next Articles

HcAnk1 and HcAnk2 genes function and HcNPV susceptibility of Hyphantria cunea based on RNAi

PENG Mengmeng¹(), WU Hongqu¹^,²(), ZHANG Jiawen¹, YAN Liqiong¹, CAO Chuanwang¹, SUN Lili¹^,^*()

1. Key Laboratory of Sustainable Forest Ecosystem Management-Ministry of Education, Northeast Forestry University, Harbin 150040, China
2. Hubei Biopesticide Engineering Research Center, Wuhan 430070, China

Received:2022-03-24 Revised:2022-09-05 Online:2024-05-30 Published:2024-06-14
Supported by:
National Natural Science Foundation of China(32171791);National College Students’ Innovation and Entrepreneurship Training Program(202010225031);Natural Science Foundation of Heilongjiang(YQ2021C007)

Abstract

Abstract:

【Objective】 Ankyrin is a family of adaptor proteins that connect the cytoskeleton to the plasma membrane. However, the functions of insect ankyrin are poorly understood. In this study, the Ankyrin genes of Hyphantria cunea were cloned and their expression characteristics were determined in different developmental stages and tissues of H. cunea. The mortality rate of H. cunea was measured under the stress of exposure to nucleopolyhedrosis virus, which provided a theoretical basis for further developing synergists for NPV-based control strategies. 【Method】 The Ankyrin1 (HcAnk1) and Ankyrin2 (HcAnk2) genes were screened by a transcriptome library, and the characteristics of the two Ankyrin genes were determined using bioinformatics. Using qRT-PCR, the expression of HcAnk1 and HcAnk2 genes were determined at different developmental stages and in different tissues, and under different HcNPV concentrations. The survival rate of H. cunea larvae under HcNPV stress was investigated after the gene silencing of HcAnk1 and HcAnk2 using an RNAi technique. 【Result】 The open reading frames of the HcAnk1 and HcAnk2 genes were 1392 and 1866 bp, encoding 463 and 621 amino acids, respectively. The molecular weights of the HcAnk1 and HcAnk2 proteins were 59.18 and 69.19 ku, respectively, and the theoretical isoelectric points were 5.74 and 8.66, respectively. A phylogenetic analysis showed that HcAnk1 was closely related to Trichoplusia ni and was clustered into one group. HcAnk1 and HcAnk2 were expressed at all developmental stages, with the highest expression in the egg stage and the lowest expression in the sixth instar larva. The highest expression of HcAnk1 and HcAnk2 was observed in the midgut and hindgut, respectively, but HcAnk1 was not detected in the ovary or testis, while HcAnk2 was mainly expressed in the midgut and testis. In tests with different levels of HcNPV stress, the transcription levels of HcAnk1 and HcAnk2 were induced at low concentrations and inhibited at high concentrations. The relative growth rate and food conversion efficiency (ECD) were significantly decreased after silencing HcAnks in H. cunea larvae. Additionally, the H. cunea with HcAnks silencing were significantly less resistant to HcNPV. 【Conclusion】 HcAnk1 and HcAnk2 play an important role in the resistance to HcNPV. HcAnk1 and HcAnk2 can be used as HcNPV synergists for the pollution-free control of H. cunea.

Key words: Hyphantria cunea, Ankyrins, Hyphantria cunea nucleopolyhedrovirus, RNAi

CLC Number:

S763.3

PENG Mengmeng, WU Hongqu, ZHANG Jiawen, YAN Liqiong, CAO Chuanwang, SUN Lili. HcAnk1 and HcAnk2 genes function and HcNPV susceptibility of Hyphantria cunea based on RNAi[J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2024, 48(3): 181-190.

Figures/Tables 7

表1

图1

图2

图3

图4

表2

图5

References 41

[1]	BENNETT P B. Anchors aweigh!:ion channels,cytoskeletal proteins,and cellular excitability[J]. Circ Res, 2000, 86(4):367-368.DOI: 10.1161/01.res.86.4.367.
[2]	HRYNIEWICZ-JANKOWSKA A, CZOGALLA A, BOK E, et al. Ankyrins,multifunctional proteins involved in many cellular pathways[J]. Folia Histochem Cytobiol, 2002, 40(3):239-249.
[3]	BOULEY M, TIAN M Z, PAISLEY K, et al. The L1-type cell adhesion molecule neuroglian influences the stability of neural ankyrin in the Drosophila embryo but not its axonal localization[J]. J Neurosci, 2000, 20(12):4515-4523.DOI: 10.1523/JNEUROSCI.20-12-04515.2000.
[4]	HORTSCH M, PAISLEY K L, TIAN M Z, et al. The axonal localization of large Drosophila Ankyrin2 protein isoforms is essential for neuronal functionality[J]. Mol Cell Neurosci, 2002, 20(1):43-55.DOI: 10.1006/mcne.2002.1113.
[5]	RUBTSOV A M, LOPINA O D. Ankyrins[J]. FEBS Lett, 2000, 482(1/2):1-5.DOI: 10.1016/s0014-5793(00)01924-4.
[6]	BENNETT V, BAINES A J. Spectrin and Ankyrin-based pathways:metazoan inventions for integrating cells into tissues[J]. Physiol Rev, 2001, 81(3):1353-1392.DOI: 10.1152/physrev.2001.81.3.1353.
[7]	CAI X J, ZHANG Y H. Molecular evolution of the ankyrin gene family[J]. Mol Biol Evol, 2006, 23(3):550-558.DOI: 10.1093/molbev/msj056.
[8]	OTSUKA A J, FRANCO R, YANG B, et al. An ankyrin-related gene (unc-44) is necessary for proper axonal guidance in Caenorhabditis elegans[J]. J Cell Biol, 1995, 129(4):1081-1092.DOI: 10.1083/jcb.129.4.1081.
[9]	DUBREUIL R R, YU J. Ankyrin and beta-spectrin accumulate independently of alpha-spectrin in Drosophila[J]. Proc Natl Acad Sci USA, 1994, 91(22):10285-10289.DOI: 10.1073/pnas.91.22.10285.
[10]	PIELAGE J, FETTER R D, DAVIS G W. A postsynaptic spectrin scaffold defines active zone size,spacing,and efficacy at the Drosophila neuromuscular junction[J]. J Cell Biol, 2006, 175(3):491-503.DOI: 10.1083/jcb.200607036.
[11]	SPURRIER J, SHUKLA A K, BUCKLEY T, et al. Expression of a fragment of Ankyrin2 disrupts the structure of the axon initial segment and causes axonal degeneration in Drosophila[J]. Mol Neurobiol, 2019, 56(8):5689-5700.DOI: 10.1007/s12035-019-1477-6.
[12]	SILVERMAN N, MANIATIS T. NF-kappaB signaling pathways in mammalian and insect innate immunity[J]. Genes Dev, 2001, 15(18):2321-2342.DOI: 10.1101/gad.909001.
[13]	THOETKIATTIKUL H, BECK M H, STRAND M R. Inhibitor kappaB-like proteins from a polydnavirus inhibit NF-kappaB activation and suppress the insect immune response[J]. Proc Natl Acad Sci USA, 2005, 102(32):11426-11431.DOI: 10.1073/pnas.0505240102.
[14]	FALABELLA P, VARRICCHIO P, PROVOST B, et al. Characte-rization of the IkappaB-like gene family in polydnaviruses associated with wasps belonging to different Braconid subfamilies[J]. J Gen Virol, 2007, 88(Pt 1): 92-104.DOI: 10.1099/vir.0.82306-0.
[15]	BITRA K, SUDERMAN R J, STRAND M R. Polydnavirus Ank proteins bind NF-κB homodimers and inhibit processing of Relish[J]. PLoS Pathog, 2012, 8(5):e1002722.DOI: 10.1371/journal.ppat.1002722.
[16]	GUEGUEN G, KALAMARZ M E, RAMROOP J, et al. Polydnaviral ankyrin proteins aid parasitic wasp survival by coordinate and selective inhibition of hematopoietic and immune NF-kappa B signaling in insect hosts[J]. PLoS Pathog, 2013, 9(8):e1003580.DOI: 10.1371/journal.ppat.1003580.
[17]	CHEN Y R, ZHONG S L, FEI Z J, et al. Transcriptome responses of the host Trichoplusia ni to infection by the baculovirus Autographa californica multiple nucleopolyhedrovirus[J]. J Virol, 2014, 88(23):13781-13797.DOI: 10.1128/JVI.02243-14.
[18]	SUN L L, LIU P, SUN S H, et al. Transcriptomic analysis of interactions between Hyphantria cunea larvae and nucleopolyhedro virus[J]. Pest Manag Sci, 2019, 75(4):1024-1033.DOI: 10.1002/ps.5212.
[19]	TAMURA K, STECHER G, PETERSON D, et al. MEGA6:molecular evolutionary genetics analysis version 6.0[J]. Mol Biol Evol, 2013, 30(12):2725-2729.DOI: 10.1093/molbev/mst197.
[20]	PFAFFL M W, HORGAN G W, DEMPFLE L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR[J]. Nucleic Acids Res, 2002, 30(9):e36.DOI: 10.1093/nar/30.9.e36.
[21]	SUN L L, WANG Z Y, WU H Q, et al. Role of ocular albinism type 1 (OA1) GPCR in Asian Gypsy moth development and transcriptional expression of heat-shock protein genes[J]. Pestic Biochem Physiol, 2016, 126:35-41.DOI: 10.1016/j.pestbp.2015.07.004.
[22]	BORK P. Hundreds of Ankyrin-like repeats in functionally diverse proteins:mobile modules that cross phyla horizontally?[J]. Proteins, 1993, 17(4):363-374.DOI: 10.1002/prot.340170405.
[23]	SEDGWICK S G, SMERDON S J. The ankyrin repeat:a diversity of interactions on a common structural framework[J]. Trends Biochem Sci, 1999, 24(8):311-316.DOI: 10.1016/s0968-0004(99)01426-7.
[24]	MOSAVI L K, CAMMETT T J, DESROSIERS D C, et al. The ankyrin repeat as molecular architecture for protein recognition[J]. Protein Sci, 2004, 13(6):1435-1448.DOI: 10.1110/ps.03554604.
[25]	HABYARIMANA F, AL-KHODOR S, KALIA A, et al. Role for the Ankyrin eukaryotic-like genes of Legionella pneumophila in parasitism of protozoan hosts and human macrophages[J]. Environ Microbiol, 2008, 10(6): 1460-1474.DOI: 10.1111/j.1462-2920.2007.01560.x.
[26]	PAN X X, LÜHRMANN A, SATOH A, et al. Ankyrin repeat proteins comprise a diverse family of bacterial type IV effectors[J]. Science, 2008, 320(5883):1651-1654.DOI: 10.1126/science.1158160.
[27]	AXTON J M, SHAMANSKI F L, YOUNG L M, et al. The inhibitor of DNA replication encoded by the Drosophila gene plutonium is a small,ankyrin repeat protein[J]. EMBO J, 1994, 13(2):462-470.DOI: 10.1002/j.1460-2075.1994.tb06281.x.
[28]	ELFRING L K, AXTON J M, FENGER D D, et al. Drosophila PLUTONIUM protein is a specialized cell cycle regulator required at the onset of embryogenesis[J]. Mol Biol Cell, 1997, 8(4):583-593.DOI: 10.1091/mbc.8.4.583.
[29]	ASP M, GIACOMELLO S, LARSSON L, et al. A spatiotemporal organ-wide gene expression and cell atlas of the developing human heart[J]. Cell, 2019, 179(7):1647-1660.e19.DOI: 10.1016/j.cell.2019.11.025.
[30]	KANG H J, KAWASAWA Y I, CHENG F, et al. Spatio-temporal transcriptome of the human brain[J]. Nature, 2011, 478(7370):483-489.DOI: 10.1038/nature10523.
[31]	FERTUZINHOS S, LI M F, KAWASAWA Y I, et al. Laminar and temporal expression dynamics of coding and noncoding RNAs in the mouse neocortex[J]. Cell Rep, 2014, 6(5):938-950.DOI: 10.1016/j.celrep.2014.01.036.
[32]	KAWANO S, BABA M, FUKUSHIMA H, et al. Autism-associated ANK2 regulates embryonic neurodevelopment[J]. Biochem Biophys Res Commun, 2022, 605:45-50.DOI: 10.1016/j.bbrc.2022.03.058.
[33]	ISLAM Z, NAGAMPALLI R S K, FATIMA M T, et al. New paradigm in ankyrin repeats:beyond protein-protein interaction module[J]. Int J Biol Macromol, 2018, 109:1164-1173.DOI: 10.1016/j.ijbiomac.2017.11.101.
[34]	BENNETT V, GILLIGAN D M. The spectrin-based membrane skeleton and micron-scale organization of the plasma membrane[J]. Annu Rev Cell Biol, 1993, 9:27-66.DOI: 10.1146/annurev.cb.09.110193.000331.
[35]	KREIS T, VALE R. Guidebook to the extracellular matrix,anchor,and adhesion proteins[M] Oxford, New York: Sambrook and Tooze Publication at Oxford University Press, 1999:340-392.
[36]	PARK J, KIM K J, CHOI K S, et al. Anaplasma phagocytophilum AnkA binds to granulocyte DNA and nuclear proteins[J]. Cell Microbiol, 2004, 6(8):743-751.DOI: 10.1111/j.1462-5822.2004.00400.x.
[37]	LIN M Q, DEN DULK-RAS A, HOOYKAAS P J J, et al. Anaplasma phagocytophilum AnkA secreted by type IV secretion system is tyrosine phosphorylated by Abl-1 to facilitate infection[J]. Cell Microbiol, 2007, 9(11):2644-2657.DOI: 10.1111/j.1462-5822.2007.00985.x.
[38]	RIKIHISA Y, LIN M Q. Anaplasma phagocytophilum and Ehrlichia chaffeensis type IV secretion and Ank proteins[J]. Curr Opin Microbiol, 2010, 13(1):59-66.DOI: 10.1016/j.mib.2009.12.008.
[39]	STRAND M R. Polydnavirus gene products that interact with the host immune system[M]//Parasitoid Viruses. Amsterdam: Elsevier, 2012:149-161.DOI: 10.1016/b978-0-12-384858-1.00012-6.
[40]	SALVIA R, GROSSI G, AMORESANO A, et al. The multifunctional polydnavirus TnBVANK1 protein:impact on host apoptotic pathway[J]. Sci Rep, 2017, 7(1):11775.DOI: 10.1038/s41598-017-11939-x.
[41]	LOPEZ-ORTIZ C, PEÑA-GARCIA Y, NATARAJAN P, et al. The ankyrin repeat gene family in Capsicum spp:genome-wide survey,characterization and gene expression profile[J]. Sci Rep, 2020, 10(1):4044.DOI: 10.1038/s41598-020-61057-4.

Metrics

Comments

www.nldxb.njfu.edu.cn

Edited ＆ Published by Editorial Department of Nanjing Forestry University(Natural Sciences Edition)
Address： No.159 Longpan Road,Nanjing 210037 Jiangsu,P.R.China
E-mail ：xuebao@njfu.edu.cn , xuebao@njfu.com.cn
Telephone +86-25-85428247,85427076
Distributed by China International Book Trading Corporation P.O. Box 399, Beijing ,P.R. China

gene 基因	forward primer sequences 正向引物序列	reverse primer sequences 反向引物序列	primer usage 引物用途
dsHcAnk1	TAATACGACTCACTATAGG GATGCCTTCAGAAGTGATATCAG	TAATACGACTCACTATAGG GAAAAGTGAGCAGCAACTCCA	RNAi
dsHcAnk2	TAATACGACTCACTATAGGG CAGAAAACTATGACATGATTACAT	TAATACGACTCACTATAGGG CAACATCGCCTATTTCTTCG
dsGFP	TAATACGACTCACTATAGGG GGAGAAGAACTTTTCACTGG	TAATACGACTCACTATAGGG AGTTGAACGGATCCATCTTC	RT-qPCR
HcAnk1	CGTGGCTCCTAGCGCTGAGG	GGAGTCTTAGCACGGTGCATTAG
HcAnk2	ATGAATCCATCCTTGGAAGACA	GCAGTGGTTTTGTTTAGAAGATC

treatment 处理	relative growth ratio (RGR) 相对生长率	relative consumption rate (RCR) 相对取食量	efficiency of ingested food (ECI) 食物利用率	efficiency of conversion of food (ECD) 食物转化率
dsGFP	74.40±0.62 a	5.92±0.71 a	12.78±1.73 a	13.56±1.84 a
dsHcAnk1	48.33±0.68 c	4.80±0.13 b	10.09±0.22 a	10.40±0.34 b
dsHcAnk2	60.14±2.53 b	7.84±1.06 a	7.81±1.09 b	8.19±0.95c

HcAnk1 and HcAnk2 genes function and HcNPV susceptibility of Hyphantria cunea based on RNAi

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 41

Related Articles 2

Recommended Articles

Metrics

Comments

Author

Reader

Reviewer

[1]	WEI Pengfei, LI Yongxia, FENG Yuqian, LIU Zhenkai, ZHANG Xingyao. Expression characteristics and biological functions of the sex determination gene Bx-sex-1 in Bursaphelenchus xylophilus [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2022, 46(4): 15-20.
[2]	JI Yelin, SU Xiyou, YU Zhijun. Potential habitat prediction of Hyphantria cunea based on a random forest model in China [J]. JOURNAL OF NANJING FORESTRY UNIVERSITY, 2019, 43(6): 121-128.